Crispr - So funktioniert das neue Universalwerkzeug der Gentechnik Günstig, leicht zu handhaben und enorm effektiv: Crispr revolutioniert die Gentechnik. Das Erbgut aller Lebewesen lässt sich damit beliebig formen, wie das Video zeigt.

In den Monaten nach Gavriels Diagnose machte sie sich Vorwürfe. Ein Gentest hatte ergeben, dass weder sie noch ihr Mann das defekte Dystrophin-Gen vererbt hatten. Etwas anderes musste die Ursache sein. Umweltgifte? Elektrosmog? Die Ernährung? Sie verbannte die Mikrowelle aus der Küche, schaltete das Wi-Fi ab, kaufte ein Telefon mit Schnur, putzte nur noch mit Essig. Sie gab Hunderte Pfund für eine Kinesiologin aus, die ihr riet, Milch, Bananen und gelbe Lebensmittelfarbe von Gavriel fernzuhalten. Die Blutwerte änderten sich nicht. Als Kerry über die Telefonschnur stolperte und aufs Gesicht stürzte, war es genug. Sie holte die Mikrowelle und das Funktelefon hervor und schaltete das Wi-Fi an. Ihr Sohn durfte wieder Bananen essen.

Gavriel weiß, dass Duchenne-Jungen nicht sehr alt werden. Aber was das für ihn bedeuten könnte, lässt er nur langsam an sich heran. Auf dem Weg zur Synagoge fragte er vor Kurzem seine Mutter:

"Wird Duchenne meine Lungen treffen?"

"Duchenne trifft jeden Muskel des Körpers", sagte Kerry.

"Wird Duchenne mein Herz treffen?"

"Duchenne trifft jeden Muskel des Körpers."

"Wird Duchenne meine Zunge und meine Fähigkeit zu essen treffen?"

Die DNA des Menschen kann man sich wie eine Strickleiter mit drei Milliarden Sprossen vorstellen. Jede Sprosse ein Molekülpaar. Viele Tausend Sprossen bilden jeweils ein Gen. Das Dystrophin-Gen ist sogar 2,4 Millionen Sprossen lang, es ist das längste im menschlichen Erbgut. Dass dieses Gen einen Fehler habe, sei nicht so ungewöhnlich, erklärte ein Arzt Kerry Rosenfeld. Genmutationen gehören zum Leben. Ohne sie hätte es keine Evolution gegeben, ohne Evolution keine Menschheit. Ein schwacher Trost, aber Kerry Rosenfeld hörte auf, sich Vorwürfe zu machen.

Am 17. August 2012, Gavriel ist zehn, erscheint in der Fachzeitschrift Science ein Aufsatz, der die Wissenschaft verändert. Ein Forscherteam unter der Leitung von Emmanuelle Charpentier und Jennifer Doudna hat die Immunabwehr von Bakterien studiert und dabei eine Entdeckung gemacht. Um sich gegen Viren zu wappnen, produzieren die Bakterien ein Molekül, das wie eine winzige molekulare Schere funktioniert. Es schneidet die DNA feindlicher Viren in Stücke. Das Besondere ist, dass die Scheren mit einem Navigationssystem ausgestattet sind: Ein Adresscode zeigt ihnen an, bei welcher Sprosse die DNA-Strickleiter zerschnitten werden soll. Charpentier und Doudna haben herausgefunden, wie man die Adresse beliebig verändern kann. Der DNA-Code, das Buch des Lebens, kann nun korrigiert werden wie ein Wikipedia-Artikel. Das ist das Versprechen, das an diesem Tag in die Welt entlassen wird.

Die Abkürzung Crispr steht für Clustered Regularly Interspaced Short Palindromic Repeats, aber das muss man sich nicht merken. Wichtig ist, dass Crispr die DNA so präzise verändern kann wie keine Gentechnik zuvor. Es ist eine Art Genchirurgie. Innerhalb von Monaten erobert Crispr die Labors weltweit. Die Sensationsmeldungen folgen im Wochentakt: Crispr schneidet Aids-Virus aus dem Erbgut; Crispr soll Schweineorgane besser transplantierbar machen; Crispr könnte die Malaria-Mücken ausrotten; Crispr soll mammutähnliche Elefanten erschaffen; Crispr heilt Mäuse von Duchenne-Muskeldystrophie.

Zwei Jahre nach Erscheinen des Science-Artikels bekommt Kerry Rosenfeld einen Anruf aus Kanada. Ronald Cohn ist am Telefon, der Kinderarzt und Genetiker. An diesem Tag hört sie das Wort Crispr zum ersten Mal. Sie versteht nicht viel, aber Ronni sagt, man könne die neue Methode an Gavriels Zellen ausprobieren. Er wolle sie nicht dazu drängen. Aber man könnte versuchen, das Dystrophin-Gen zu korrigieren.

An dieser Stelle muss man an das Schicksal eines anderen Jungen erinnern. Denn schon einmal gab es viel Aufregung um vermeintlich revolutionäre Gentherapien. Doch am 17. September 1999 starb der 18-jährige Jesse Gelsinger in den USA, nachdem Ärzte ihm Billionen Viren in die Blutbahn gespritzt hatten. Die Viren sollten als U-Boot dienen, um ein Korrekturgen in die Körperzellen zu bringen. Stattdessen brachten sie Jesse Gelsinger den Tod. Organversagen. Danach wurde es still um die Gentherapien. Nun wird es wieder laut, und das liegt an Crispr. Die Frage ist, was die Ärzte seit dem Fall Gelsinger dazugelernt haben.

Gavriels Zellen reisen auf Trockeneis nach Toronto, ein Fetzen Haut, Luftpost. In London bleibt ein Zwölfjähriger mit einer Narbe am linken Oberarm zurück, in Toronto erreicht das Paket im November 2014 das Labor 3677 des SickKids Hospital. SickKids ist eines der besten Kinderkrankenhäuser weltweit, der angeschlossene Forschungsturm hat 21 Stockwerke. An diesem Krankenhaus arbeitet Ronald Cohn, den manche seiner kleinen Patienten auch Dr. Ice Cream nennen, weil sein Nachname wie cone klingt, Eiswaffel.

Ronald Cohn, aufgewachsen in Düsseldorf, Medizinstudium in Essen, ausgewandert mit 28, Tatort-Fan, hat sich auf Muskelerkrankungen und seltene Krankheiten spezialisiert. Sein Chemielehrer hatte ihn ausgelacht, als er damals erklärte, er wolle Medizin studieren wie sein Opa. Abiturnote 3,0. Cohn ist dann trotzdem Arzt geworden, und wenn man den Eltern seiner Patienten glaubt, macht er seinen Job gut. Sie haben ihm ein Fotobuch geschenkt. Eine Mutter schreibt: "Nach Dutzenden von Ärzten, die mit unserer Tochter in furchterregendem Krankenhausjargon sprachen, beeindruckte uns die simple Geste von Dr. Cohn, sich zu unserer Tochter herabzubeugen und zu fragen, wie es ihr geht." Ein Vater: "Als Gott den Beruf des Arztes schuf, hatte er Ronni Cohn im Sinn." Cohn gibt den Eltern seine Handynummer. Er beantwortet ihre Mails auch am Sabbat. Er weint auch mal, wenn seine Patienten sterben. Er sagt: "Wenn du aufhörst, emotional involviert zu sein, musst du dir etwas anderes suchen." Mit den Rosenfelds hat er sich angefreundet.

Cohn hat sein Büro im neunten Stock eines weiteren SickKids-Forschungsturms, er leitet die Abteilung für Clinical and Metabolic Genetics. Er redet leise und mit sanfter Stimme, er hat ein weiches Gesicht, und es fällt schwer, zu glauben, dass dieser zurückhaltende Mann demnächst die Leitung der gesamten Kinderheilkunde übernimmt. Er wird dann rund 450 Ärzte und Wissenschaftler unter sich haben und ein Budget von fast 100 Millionen Euro verwalten. Sein Chemielehrer in Düsseldorf hat ihn unterschätzt.

Gavriels Genmutation ist für die Genchirurgen besonders interessant: Ein kleiner Abschnitt seines Dystrophin-Gens ist doppelt vorhanden. 139.000 von 2,4 Millionen DNA-Sprossen. Man muss das doppelt vorhandene Stück nur herausschneiden. Zwei Molekularbiologinnen in Cohns Forschungsgruppe, Daria Wojtal und Dwi Kemaladewi, machen sich an die Arbeit. Sie analysieren Gavriels DNA und verorten die Adresse der Verdopplung. Es ist die Basenfolge AATATCTTCTTAAATACCCG, sie steht am Anfang und am Ende der Genverdopplung. Daria Wojtal bestellt die Crispr-Zutaten im Internet. Die Molekülscheren kosten 65 Dollar, das Adressmolekül sieben Dollar, plus Versandkosten. "Es ist wie Onlineshopping", sagt sie.

Dwi Kemaladewi vergleicht Gavriels DNA mit einem fehlerhaften Kochrezept. Der fertige Mensch, das ist die Suppe. Aber aus Versehen steht in dem Rezept gleich zweimal die Zeile "Ein Teelöffel Salz". Crispr soll die doppelte Anweisung entfernen, damit die Suppe nicht mehr versalzen ist.